Powered By Bing

Large Scale Sequence Analysis of Avian Influenza Isolates

Table S5. Primers used for amplification and sequencing.

The 534 primers we developed to amplify and sequence are diverse virus collection are listed here. Along with the primer name and sequence, we have indicated the target gene, its approximate binding position on that gene (in base numbers), and the primerís direction.

Primer Sequence Gene Position Direction
A001 TATTCGTCTCAGGGAGCGAAAGCAGGCA PB1 1 Forward
A002 ATATCGTCTCGTATTAGTAGAAACAAGGCATTT PB1 2341 Reverse
A003 TATTCGTCTCAGCTGTACCATCTATTAATAGAGGCCTTAT PB1 1225 Reverse
A004 TATTCGTCTCAGGGAGAGCACTGACATTGAACACAATG PB1 683 Forward
A005 CCCAGGRMTYTTTGAGAACTC PB1 321 Forward
A006 CATTTTCTTGGTCATGTTG PB1 621 Reverse
A007 TACCAAATGGAATGAGAATC PB1 941 Forward
A008 GATTTTCATTCCATTTGGTGTT PB1 961 Reverse
A009 GGAGCTGCCCAGCTTTGGAG PB1 1545 Forward
A010 CTCCAAAGCTGGGCAGCTCC PB1 1564 Reverse
A011 AACAATGCTGTGGTGATGCC PB1 1944 Forward
A012 GGCATTACCACAGCATTGTT PB1 1964 Reverse
A013 GTGGGATTCTTCAAGGAAAGCCATTGC PB1 333 Reverse
A014 TAGATTTTCTCAAGGATGTGATGGA PB1 533 Forward
A015 ACAGCCTCATTGAGTCCTGGAATGATGATG PB1 1224 Forward
A016 AGCGAAAGCAGGCAAACCATTTGAATG PB1 20 Forward
A017 TATTGCTCCTATAATGTTYTC PB1 1014 Forward
A018 ACTCAGATACCTGCAGARATG PB1 1120 Reverse
A019 CCAAGAGTATGGAGTATGATG PB1 1955 Forward
A020 AATTCTTCCCTAGTAGTTCATA PB1 2115 Forward
A021 GTCTGAGCTCTTCAATGGTGGAAC PB1 2288 Reverse
B001 TATTGGTCTCAGGGAGCGAAAGCAGGTC PB2 1 Forward
B002 ATATGGTCTCGTATTAGTAGAAACAAGGTCGTTT PB2 2341 Reverse
B003 ATATGGTCTCGTATTAATCTTCTTGTGAGAACACCAT PB2 1252 Reverse
B004 TATTGGTCTCAGGGAGTGGATATATGCAAGGCAGCAATGG PB2 949 Forward
B005 ATCATGGAGGTTGTTTTCCCHAA PB2 514 Forward
B006 CCRAAGCTRAADGAHGARCT PB2 1007 Reverse
B007 TGGGNGTRGATGARTAYTC PB2 1475 Forward
B008 GARTAYTCATCYACNCCCA PB2 1493 Reverse
B009 AGRGGHTCDGGRATGAGAATAC PB2 1948 Forward
B010 ATTCCKGAGCCTCTCACATTCACAG PB2 1962 Reverse
B011 TTCATTTGGGAAAACGACCTCCATG PB2 555 Reverse
B012 CAACCCTCCGTCTTATCTTAACTTG PB2 478 Reverse
B013 TGCTGGGAACAGATGTACACTCC PB2 756 Forward
B014 TGTGGATATATGCAAGGCAGCAATGG PB2 959 Forward
B015 ATATGGTCTCGTATTGCTCTATTGACGAAGTTCAGATC PB2 1267 Reverse
B016 AGCGAAAGCAGGTCAAWTATATTCAATATG PB2 1 Forward
B017 AAACCCTGGSCATGCAGATCTTAGTGC PB2 494 Reverse
B018 AAGGCAGTTCGGGGTGATCTGAA PB2 1283 Reverse
B019 AATAGCTGTTGCTCTTCTCCCAACCATTGT PB2 1117 Reverse
B020 ATGATCGGGATATTGCCCGACATG PB2 1406 Forward
B021 TATTCGTCATCAATGATGTGGG PB2 1616 Forward
B022 TGAGGACACTGTTCCAGCAGATG PB2 1814 Forward
B023 AAACAATTCGACACTAATTGATGGCCAT PB2 2293 Reverse
B024 TGGAGTGTACATTTGTTCCCAGCA PB2 765 Reverse
B025 ACAGTTTCCCAGTTTCTGATGA PB2 1706 Reverse
B26 TCTGTCCTTGTTCATTCCTCT PB2 233 Reverse
B27 AACTAACTCTCTTTCTAGCATGTA PB2 640 Reverse
B28 GAGGATTAGCTCATCTTTCAGC PB2 978 Forward
C001 TATTCGTCTCAGGGAGCGAAAGCAGGTAC PA 1 Forward
C002 ATATCGTCTCGTATTAGTAGAAACAAGGTACTT PA 2233 Reverse
C003 ATATCGTCTCGTATTACATACAGGAACATGGGCCT PA 1718 Reverse
C004 TATTCGTCTCAGGGAATGAAGAAAACAAGCCAGTT PA 1102 Forward
C005 GGGAYTCCTTTCGTCAGTCCG PA 587 Forward
C006 CGGATTGACGAAAGGAGTCCC PA 607 Reverse
C007 CCAARRACNAARAAYATGAARAA PA 1087 Forward
C008 TTYTTCATRTTYTTNGTYYTTGG PA 1109 Reverse
C009 GGARTTYTCYCTYACWGAYCC PA 1543 Forward
C010 GGRTCWGTRAGRGARAAYTCC PA 1613 Reverse
C011 GARCCTTCYTCCACYCCYTTRGG PA 1919 Reverse
C012 ATATCGTCTCCAGGGCTGTGTTTATGTACACTCCC PA 1407 Reverse
C013 ATTCAACAGGGCTGTGTTTATGTACACTCCC PA 1408 Reverse
C014 AGAGTCTAGATCACTAGCAAGCTGGAT PA 1218 Forward
C015 TGTGTCTTCTCGGATTTTATCTTGTTGGC PA 455 Reverse
C016 CCYAARGGRGTGGARGAAGGYTC PA 1897 Forward
C017 AGCAAAAGCAGGTACTGATTCGAGATG PA 20 Forward
C018 GCTGTATGATGCKATCAAGTGYAT PA 915 Forward
C019 GAGAACCGATTCATYGAGATTGG PA 368 Forward
C020 TCAGGCTCTTAGGGACAATCTKGAGCCTG PA 2050 Forward
C021 ATGGATAGCAAATAGTAGCATTGCCACAAC PA 2206 Reverse
C022 ATGCTTAGTTTTAGGGCATCCATCA PA 898 Reverse
C023 TCTCCTTGTTACTCCAATTTCGATGAA PA 399 Reverse
C24 AAGAGGGCTCCATCGGAAA PA 1910 Forward
D001 TATTCGTCTCAGGGAGCAAAAGCAGGGG HA 1 Forward
D002 ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT HA 890 Reverse
D003 TATTCGTCTCAGGGAGCAAAAGCAGGGGTTATAC HA 1 Forward
D004 TATTCGTCTCAGGGAGCAAAAGCAGGGGATAATTC HA 1 Forward
D005 TTCTTCMGGAATATGGTTTGGCTTAC HA 511 Forward
D006 TGTAAGCCAGACCATRTTCCKGAAGAA HA 536 Reverse
D007 TGGGAGCAATAAATACAAC HA 929 Forward
D008 TGAAAGGGTAATGTTGTRTTTATTGCTCC HA 960 Reverse
D009 AATTCTGTGATTGAGAAGATGAATAC HA 1220 Forward
D010 AGGTCAGAATGCAGTTGAGAGAC HA 1425 Forward
D011 CACTGTTCATGCATTCATCATCACATT HA 1517 Reverse
D012 TATTCGTCTCAGGGAGCAAAAGCAGGGGAAAATG HA 1 Forward
D013 TAGATACTAATAGCGGAGTTACGA HA 450 Forward
D014 TCGTAACTCCGCTATTAGTATCTA HA 476 Reverse
D015 TGAGAAATGTTCCACAGGCAGAAAC HA 1050 Forward
D016 GTTTCTGCCTGTGGAACATTTCTCA HA 1074 Reverse
D017 AATGCTGAACTTCTGGTTCTGCTGG HA 1367 Forward
D018 CCAGCAGAACCAGAAGTTCAGCATT HA 1389 Reverse
D019 GCAGCAGACAAAGAATCCACTC HA 1165 Forward
D020 GAGTGGATTCTTTGTCTGCTGC HA 1185 Reverse
D021 GTTTACTTTGGGTCTTGTTGC HA 744 Reverse
D022 TAAGAGGTCAATCCCWGAAATAG HA 702 Forward
D023 TTTGAAATGTTCCCCAAGAGCAC HA 384 Forward
D024 GTGCTCTTGGGGAACATTTC HA 394 Reverse
D025 ATAGCTCCTTGGTATGCTTAC HA 800 Forward
D026 GTAAGCATACCAAGGAGCTAT HA 820 Reverse
D027 TGGACATACAATGCTGAAC HA 1308 Forward
D028 GTTCAGCATTGTATGTCCA HA 1327 Reverse
D029 ATATACATATCTTGCATTGCATTG HA 1700 Reverse
D030 TTCTGGGGTGTGCACCATCCC HA 591 Reverse
D031 GGGATGGTGCACACCCCAGAA HA 610 Reverse
D032 TGATGATCATATGCAGATTCTGC HA 1738 Reverse
D033 TATTCGTCTCAGGGAGCAAAAGCAGGGGAAAAT HA 1 Forward
D034 TATTCGTCTCAGGGAGCAAAAGCAGGGGAAAATAAAAAC HA 1 Forward
D035 TATTCGTCTCAGGGAGCAAAAGCAGGGGAAAC HA 1 Forward
D036 TATTCGTCTCAGGGAGCAAAAGCAGGGGTAC HA 1 Forward
D037 TATTCGTCTCAGGGAGCAAAAGCAGGGGTAT HA 1 Forward
D038 TATTCGTCTCAGGGAGCAAAAGCAGGGGATAC HA 1 Forward
D039 TATTCGTCTCAGGGAGCAAAAGCAGGGGTCACAATG HA 1 Forward
D040 TATTCGTCTCAGGGAGCAAAAGCAGGGGAAT HA 1 Forward
D041 TATTCGTCTCAGGGAGCAAAAGCAGGGGAATC HA 1 Forward
D042 TATTCGTCTCAGGGAGCAAAAGCAGGGGTC HA 1 Forward
D043 TATTCGTCTCAGGGAGCAAAAGCAGGGGATC HA 1 Forward
D044 TATTCGTCTCAGGGAGCAAAAGCAGGGGATCAATC HA 1 Forward
D045 TATTCGTCTCAGGGAGCAAAAGCAGGGGTCACAATG HA 1 Forward
D046 TATTCGTCTCAGGGAGCAAAAGCAGGGGAAATAT HA 1 Forward
D047 TATTCGTCTCAGGGAGCAAAAGCAGGGGAAAATG HA 1 Forward
D048 AGCAAAAGCAGGGGAAACAATGCTATC HA 27 Forward
D049 GAATGGGATGTCTTCATAGAGC HA 302 Forward
D050 GCTCTATGAAGACATCCCATTC HA 323 Reverse
D051 ACAATGGGAAATTTGAGTTCATTG HA 400 Forward
D052 CAATGAACTCAAATTTCCCATTGT HA 420 Reverse
D053 TACATATGGGGAGTTCATCA HA 590 Forward
D054 TGGTGAACTCCCCATAKGTA HA 609 Reverse
D055 AATCWCTACAACTAAGCCCTTTC HA 920 Forward
D056 AGATGTTTTGAAAGGGTTTAGTTGTGG HA 920 Reverse
D057 AGAGGTCTATTTGGTGCAATTGCTGGC HA 1050 Forward
D058 GCCAGCAATWGCWCCAAATAGTCCTCT HA 1087 Reverse
D059 ATGAACAAACTCTTTGAAAGAG HA 1391 Forward
D060 CTCTTTCAAAGAGTTTGTTCAT HA 1412 Reverse
D061 GACCATGATATTTATAGAGATGA HA 1520 Forward
D062 TCGTCTCTGTAAATATCATGGTC HA 1530 Reverse
D063 TAAATGCAAATCTGGCACCGGATGTTTC HA 1713 Reverse
D064 GAAAATAAAAACAACCAAAATGAAG HA 50 Forward
D065 TCATGGTCCTACATWGTAGAAAC HA 300 Forward
D066 TTTGGTGTTTCTACAATGTAGGACC HA 330 Reverse
D067 AATGGAGCATGTTATCCMGG HA 342 Forward
D068 TAGTCTATGAAWTCWCCKGGGTAGCA HA 380 Reverse
D069 CTCTGGGGKGTKCATCACCC HA 650 Forward
D070 CTTGGAGGGTGGTGMACMCCCCA HA 630 Reverse
D071 TGATAGGGTGTACATTCTGGAAAGG HA 950 Reverse
D072 AGCAGCCTTCCTTTTCAGAATGTAC HA 948 Forward
D073 TTGGGGCCATTGCCGGCTTTATTGAGG HA 1070 Forward
D074 CCCTCAATGAATCCAGCAATTGCTCC HA 1099 Reverse
D075 GCCGAATTGTTCGTTCTACTKGAAAAT HA 1350 Forward
D076 CAAGTAGGACKAGCAGTTCKGCATTGTA HA 1350 Reverse
D077 TGGTTGTTTTGAGTTCTATCA HA 1470 Forward
D078 TGGTAGAACTCAAAACAACC HA 1490 Reverse
D079 TTAAATGCATATTCTGCATTG HA 1710 Reverse
D080 AGAGGNCTNTTTGGNGCNATNGCNGG HA 1060 Forward
D081 CCNGCNATNGCNCCGAANAKNCCTCT HA 1060 Reverse
D082 GATAATTCTATTAATTATGAAGAC HA 15 Forward
D083 GGGACCCTCATTGTGATGTATTTCAA HA 275 Forward
D084 TTGAAATACATCACAATGAGGGTCCC HA 290 Reverse
D085 GAGCGCAGCAATGCCTTCAGCA HA 310 Forward
D086 ATGGGTAGCAGTTGCTGAAGGCATTGC HA 340 Reverse
D087 GGGAGTTCATCATCCAAGCACAA HA 590 Forward
D088 TTGTGCTTGGATGATGAACTCCC HA 610 Reverse
D089 TCACTTACGGAGCATGTCCTAAGTAT HA 950 Forward
D090 ATACTTAGGACATGCTCCGTAAGTGA HA 970 Reverse
D091 GTCTGTTCGGTGCAATAGCAGG HA 1035 Forward
D092 TTTTCTATGAACCCTGCTATTGCACCG HA 1070 Reverse
D093 TGGTCTTACAATGCGGAACTTCTT HA 1310 Forward
D094 CACAAGAAGTTCCGCATTGTAAGACC HA 1335 Reverse
D095 GGCTGTTTCAAAATATACCACAAATGTG HA 1440 Forward
D096 CACATTTGTGGTATATTTTGAAACAGCC HA 1470 Reverse
D097 ATATACTCAAATGCAAATGTTGCACC HA 1700 Reverse
D098 TTGCAATAGTCAGTCTTGTTAAAAGT HA 40 Forward
D099 TTCATCAATGTGCCGGAATGGTC HA 255 Forward
D100 CTTCTCCACTATGTAAGACCATTCCGG HA 295 Reverse
D101 ATTTCAATGACTATGAAGAATTGAA HA 330 Forward
D102 CTGCTCAATAGGTGTTTCAATTCTTCATA HA 370 Reverse
D103 GTAATGAATACCCAACAATAAAGAGGA HA 530 Forward
D104 TTATTGTAGGTCCTCTTTATTGTTGG HA 550 Reverse
D105 AGAGTGTCCCAAATATGTCAAATCA HA 950 Forward
D106 CAGTTTATCTGATTTGACATATTTGGG HA 980 Reverse
D107 AGAGGTCTGTTTGGAGCAATAGCAGGA HA 1050 Forward
D108 AATCCTGCTATTGCTCCAAACAGACCTC HA 1070 Reverse
D109 TGGTGCTCATGGAAAATGAAAGGACT HA 1340 Forward
D110 GAAATCCAGAGTTCTTTCATTTTCCAT HA 1370 Reverse
D111 AGTGTGAGAAATGGAACGTATGACTAT HA 1520 Forward
D112 GATAGTCATACGTTCCATTTCTCACACT HA 1550 Reverse
D113 GACCAGCTACCATGATTGCCAGTGCTA HA 1630 Reverse
D114 TCACAATTAAACAAAATGGAAATAAC HA 30 Forward
D115 AGGGAAAGAATGGTCCTACATTGT HA 300 Forward
D116 GATCTCTCGACAATGTAGGACCATTC HA 320 Reverse
D117 GCTGTCAATGGAATGTGTTACCCTGG HA 340 Forward
D118 TTTCCAGGGTAACACATTCCATTGAC HA 370 Reverse
D119 GGAAAAATATTCTCTTCATGTGGG HA 570 Forward
D120 GTGGGGCATACACCATCCACC HA 590 Forward
D121 ATCTGTAGGTGGATGGTGTATGCCCCA HA 610 Reverse
D122 GCAGTGGCGACTGCGTAGTGCAGTG HA 875 Forward
D123 TTAGACCACCTTTCTCAGTCTGGCATTG HA 910 Reverse
D124 CCAAAATATGTTGGAGTAAAGAGTCTC HA 970 Forward
D125 GAGACTCTTTACTCCAACATATTTTGG HA 990 Reverse
D126 TAGCTGGATTCATAGAAGGAGGTTGG HA 1060 Forward
D127 CCAACCTCCTTCTATGAATCCAGCTA HA 1080 Reverse
D128 TATAACGCAGAATTGCTAGTACTGCTTG HA 1310 Forward
D129 AGCGTTTTCTGATTTTCAAGCAGTACTAGC HA 1340 Reverse
D130 GGATGCTTCGAGTTGTATCATAAATG HA 1450 Forward
D131 CGCATTTATGGTATAGCTCGAAGCATCC HA 1470 Reverse
D132 CTGCAGGATCCATTGGACATGGCC HA 1670 Reverse
D133 AGCAAAAGCAGGGGATACAAAATG HA 25 Forward
D134 AACCGATGTGTGTTATCCTGGGAA HA 330 Forward
D135 CCTCAGTGATTCTTCATTTGTGAACTTCC HA 350 Reverse
D136 ACCTATAGTGGAATAAGAACCAATGG HA 430 Forward
D137 CCGCATAGAAWGAAGAWCCTGATCT HA 480 Reverse
D138 AAGACCCAGCTCTGATAATATGGGG HA 565 Forward
D139 TGGATCCCCCATATTATCAGAGCTGG HA 600 Reverse
D140 ACACAGTGACCTTCACTTTCAATG HA 770 Forward
D141 CATTGAAAGTGAAGGTCACTGTGT HA 795 Reverse
D142 GGAAAATGTCCGAGATATGTTAAGCA HA 960 Forward
D143 TGTCTGTTTGACATATCGAGGGCATTTCCC HA 980 Reverse
D144 TATAGCGGGTTTCATTGAAAATGGATGG HA 1060 Forward
D145 CATACCATCCATCGATGAGACCTTCCCA HA 1085 Reverse
D146 TATAATGCTGAGCTGTTGGTGGCARTG HA 1360 Forward
D147 TCCATTGCTACTAAGAGTTCAGCGTTGTA HA 1352 Reverse
D148 AATTGATCTGGCCGACTCAGAAATGA HA 1365 Forward
D149 AGATGGCACTGGTTGCTTCGAAATAT HA 1450 Forward
D150 TGTGAAATATTTCGAAGCAACCAGTGCC HA 1450 Reverse
D151 TTCTCAAACTATATACAAATAGTGCA HA 1700 Reverse
D152 AGCAAAAGCAGGGGTCACAATGT HA 25 Forward
D153 AATGCCATTGCCTACTGTTATCC HA 310 Forward
D154 TTATGGTTGTTCCAGGGTAACAGT HA 330 Reverse
D155 AGTTTCTATGCAGAGGTCAAATGGCTAGT HA 480 Forward
D156 ACTAGCCATTTGACCTCTGCATAGAAACT HA 510 Reverse
D157 TGGGGAATTCACCATCCTTCCAGC HA 600 Forward
D158 GCTGGAAGGGTGGTGAATTCCCCA HA 610 Reverse
D159 AGAGGTCTATTTGGTGCAATAGCAGG HA 1060 Forward
D160 TTCTATGAATCCTGCTATTGCACC HA 1080 Reverse
D161 AGGCTGAACTATTGGTGGCAATGGAGA HA 1320 Forward
D162 ATGTCAATTGTGTGCTGGTTCTCCAT HA 1350 Reverse
D163 AGATGGGAAGGGGTGTTTTGAG HA 1440 Forward
D164 CTCCATGCATGAATCGTCACAAGTATGATAT HA 1450 Reverse
D165 AATACAGATTGTGCATCGCATGTTTC HA 1700 Reverse
D166 ATCAATCAAGAAATCAAAATGGAGAA HA 40 Forward
D167 GGAGTTCACCATCCTGCAACTCT HA 580 Forward
D168 TTCCTTTAGAGTTGCAGGATGGTG HA 600 Reverse
D169 GGTGCAATAGCTGGTTTCATAGAAGG HA 1060 Forward
D170 AACCACCTTCTATGAAACCAGCTATTGC HA 1080 Reverse
D171 ACAGCTTCTCGTTTTACTTGAAAATGA HA 1330 Forward
D172 CATTTTCAAGTAAAACGAGAAGCTGTGCA HA 1350 Reverse
D173 AGCAAAAGCAGGGGTCACAATGG HA 25 Forward
D174 TGCTATCCAGGATCAATTGAAAACC HA 320 Forward
D175 GGTTTTCAATTGATCCTGGGTAGCA HA 360 Reverse
D176 CATGTGGGCAATTCACCACCCACCAAC HA 580 Forward
D177 AAATGTTGGTGGGTGGTGAATTGCC HA 610 Reverse
D178 GGCGGATGGCCAGGACTAGTGGCT HA 1060 Forward
D179 AGCCACTAGTCCTGGCCATCCGCC HA 1080 Reverse
D180 TACAATGCTGAATTGCTTGTCCTATTG HA 1320 Forward
D181 CAATAGGACAAGCAATTCAGCATTGTA HA 1350 Reverse
D182 TTCAACAAACTGACACAAGAGAAATGGA HA 45 Forward
D183 TCATGGACTGTGCTACCCAGGAGA HA 330 Forward
D184 ATTGTTGTCTAACTCTCCTGGGTAGC HA 360 Reverse
D185 AGATGTTTTGGTCATGTGGGGGATACA HA 580 Forward
D186 GTGGAAACAGGATGATGTATCCCCCA HA 600 Reverse
D187 GGAGCTATTGCAGGCTTCATAGAAGG HA 1060 Forward
D188 CCTTCTATGAAGCCTGCAATAGCTCC HA 1090 Reverse
D189 TGTGTGGTCGTACAATGCTAAGCTTCTTG HA 1330 Forward
D190 ACAAGAAGCTTTGCATTGTATGACCA HA 1350 Reverse
D191 TATTCGTCTCAGGGAGCAAAAGCAGGGGAA HA 1 Forward
D192 TATTCGTCTCAGGGAGCAAAAGCAGGGGATATTGTC HA 1 Forward
D193 CTGGACAGCTGAAGCTTGCAACTGG HA 1006 Forward
D194 CCAGTTGCAAGCTTCAGCTGTCCAG HA 1031 Reverse
D195 ACTATGATTCAATAAGAGGGGAATTC HA 1246 Forward
D196 GAATTCCCCTCTTATTGAATCATAGT HA 1272 Reverse
D197 AATCATGAAGACTACAGGGAAGAATCAC HA 1540 Forward
D198 GTGATTCTTCCCTGTAGTCTTCATGATT HA 1560 Reverse
D199 AATAAAGTTGAAGACTGAAGACAATGTG HA 1600 Forward
D200 CACATTGTCTTCAGTCTTCAAC HA 1620 Reverse
D201 TAGTACTCTGGGGCATTCACCATCC HA 570 Forward
D202 TCTGTATCCGGATGGTGAATGCCCCA HA 605 Reverse
D203 TATTCGTCTCAGGGAGCAAAAGCAGGGGTC HA 1 Forward
D204 TATTCGTCTCAGGGAGCAAAAGCAGGGGTA HA 1 Forward
D205 TATTCGTCTCAGGGAGCAAAAGCAGGGGTTAC HA 1 Forward
D206 GCTCAATTGACCTCGTTGAAACAAACC HA 173 Forward
D207 GGTTTGTTTCAACGAGGTCAATTGAGC HA 200 Reverse
D208 GATGAAAATCTATTGGCACCTAATG HA 755 Forward
D209 CATTAGGTGCCAATAGATTTTCATC HA 782 Reverse
D210 GATCAAGGTTGGTCATACATAGTGG HA 290 Forward
D211 CTGGGCCTTTCCACTATGTATGACCA HA 290 Reverse
D212 ACCAGAGGGAATGTGTTACCCTGG HA 325 Forward
D213 TTTTCCACAGATCCAGGGTAACACAT HA 350 Reverse
D214 AGACATCATTTTCTTATGGGGGATCC HA 580 Forward
D215 GGATCCCCCATAAGAAAATGATGTC HA 600 Reverse
D216 GAATTGTAACACAAAATGTCAAAC HA 890 Forward
D217 TCCTGCGTATGTTTGACATTTTGTG HA 920 Reverse
D218 ATGGGAGAATGTCCCAAATATGT HA 970 Forward
D219 ACATATTTGGGACATTCTCCCA HA 990 Reverse
D220 GGCTTACAATGCAGAGCTCCTTGTGCT HA 1300 Forward
D221 TAAAAGCACAAGGAGCTCTGCATTGTA HA 1330 Reverse
D222 GGTTGCTTCGACATACTTCACAAATG HA 1435 Forward
D223 CATTTGTGAAGTATGTCGAAGCAACC HA 1460 Reverse
D224 ATTAAACCTCCAGCAATCAGGATTGCC HA 1650 Reverse
D225 AGAATACAGATAAACCCAGTGAAA HA 1550 Forward
D226 AAATAGACTCGGTAAAGCTAGAA HA 1564 Forward
D227 TATTCGTCTCAGGGAGCAAAAGCAGGGGATACAAAATG HA 1 Forward
D228 CACAGTTGCGCCTGGATAACAGTAGGC HA 360 Reverse
D229 TTACCTAAGTCTTTGTAATTCCGGCTTTTC HA 230 Reverse
D230 CTTCTGGGTACAAAGATGTTATATTATGGTTTAG HA 1600 Forward
D231 ATAATATAACATCTTTGTACCCAGAAG HA 1620 Reverse
D232 AACACGGAGTTCGAATCCATAGAATCTGAA HA 1240 Forward
D233 TTCAGATTCTATGGATTCGAACTCCGTGTT HA 1260 Reverse
D234 CGTTTGCAGGACACCACTTGGGATGTCTTC HA 300 Forward
D235 GAAGACATCCCAAGTGGTGTCCTGCAAACG HA 320 Reverse
D236 CCATTCGACGTCCCAGATTACCAGAGT HA 370 Forward
D237 ACTCTGGTAATCTGGGACGTCGAATGG HA 390 Reverse
D238 GACGGATCAAGCAGTGCTTGTTTGAG HA 460 Forward
D239 CTCAAACAAGCACTGCTTGATCCGTC HA 490 Reverse
D240 GAGAAGTACGTTGAGGACACTAAGATTGA HA 1300 Forward
D241 TCAATCTTAGTGTCCTCAACGTACTTCTC HA 1330 Reverse
D242 AATTAAGAGAGAATGCAGAAGATCAAGGCA HA 1430 Forward
D243 TGCCTTGATCTTCTGCATTCTCTCTTAATT HA 1430 Reverse
D244 TACAGGGATGAAGCCATCAACAATCGAATC HA 1545 Forward
D245 GATTCGATTGTTGATGGCTTCATCCCTGTA HA 1575 Reverse
D246 AGAAGAAATTCAAGTGACATCTGTTACCCA HA 320 Forward
D247 TGGGTAACAGATGTCACTTGAATTTCTTCT HA 340 Reverse
D248 CCAGTGCGTGTAAGAGAACAGTGTCCTC HA 450 Forward
D249 GAGGACACTGTTCTCTTACACGCACTGG HA 470 Reverse
D250 CCTTGGATGAGCAAAATAAGCTATATGGA HA 600 Forward
D251 TCCATATAGCTTATTTTGCTCATCCAAGG HA 630 Reverse
D252 AGCAGCAGATAGGCAATGTAATAAACTGGA HA 1290 Forward
D253 TCCAGTTTATTACATTGCCTATCTGCTGCT HA 1330 Reverse
D254 GAGATTTTCCACCGATGTGACGATCAATG HA 1480 Forward
D255 CATTGATCGTCACATCGGTGGAAAATCTC HA 1510 Reverse
D256 GGACATCATCCTCTGGATTT HA 1597 Forward
E001 TATTCGTCTCAGGGAGCAAAAGCAGGGTA NP 1 Forward
E002 ATATCGTCTCGTATTAGTAGAAACAAGGGTATTTTTC NP 1565 Reverse
E003 GGAATGGAYCCCAGGATGTGCTC NP 517 Forward
E004 TGCATTAGAGAGCACATTCTGGGGTCC NP 548 Reverse
E005 TGTGGATGGCATGCMATTCTGCHGC NP 1031 Forward
E006 CAAATGCWGCAGAGTKGCATGCCATCC NP 1060 Reverse
E007 TTCATCAAATGCAGAGAGTACCATTCTCTC NP 264 Reverse
E008 CACCAACCAGCAGAGGGCATCTGC NP 1230 Forward
E009 CACTCACTGAGTGACATCAAMATCATG NP 40 Forward
E010 AATTTCCCTTTGAGGATGTTGCACATTC NP 734 Reverse
E011 GAATGTGCAACATTCTCAAGG NP 706 Forward
E012 GAATGTGCAACATTCTCAA NP 705 Forward
E013 TTGAGGAGCAGATACTGGGCTATAAG NP 1185 Forward
E014 ATAGCCCAGTATCTGCTTCTCAGTTC NP 1210 Reverse
E015 ATATTCCTCTGCATTGTCTCCGA NP 1533 Reverse
E16 TATTCGTCTCAGGGAGCAAAAGCAGGGT NP 1 Forward
E17 ATATCGTCTCGTATTAGTAGAAACAAGGGTATTT NP 1565 Reverse
F001 TATTGGTCTCAGGGAGCAAAAGCAGGAGT NA 1 Forward
F002 ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTTT NA 1413 Reverse
F003 TATTCGTCTCAGGGAGCAAAAGCAGGGTGAAAATG NA 1 Forward
F004 TATTCGTCTCAGGGAGCAAAAGCAGGGTGATTGAGAATG NA 1 Forward
F005 TATTCGTCTCAGGGAGCAAAAGCAGGTGC NA 1 Forward
F006 ATATCGTCTCGTATTAGTAGAAACAAGGTGCTTTTT NA 1420 Reverse
F007 TATTCGTCTCAGGGAGCAAAAGCAGGGTC NA 1 Forward
F008 ATATCGTCTCGTATTAGTAGAAACAAGGGTCTT NA 1467 Reverse
F009 AGCAGCAGTTGCTTTGACGGGAAAGAGTG NA 570 Forward
F010 TTCCCAAGTACAGGAGCTGTTC NA 510 Reverse
F011 ACATTATTGAAGGGTCAGCTGGCCTGGG NA 1000 Reverse
F012 CAACAGTRTCATGTGATTCYCCAA NA 1030 Forward
F013 ACGCCCATTGATGTACTGCC NA 800 Forward
F014 ACATCTACGTATTAGTCATCGC NA 820 Reverse
F015 CAGAGATAGTATATTTGAATAATACTAC NA 188 Forward
F016 GTAGTATTATTCAAATATACTATCTCTG NA 215 Reverse
F017 AGGGGACCACGCTGGACAACAAACA NA 407 Forward
F018 TGTTTGTTGTCCAGCGTGGTCCCCT NA 430 Reverse
F019 TTATCGGACCCTTTTGATGAATG NA 500 Forward
F020 AAAAGGGTCCGATGAGGGCTTCTATCAT NA 515 Reverse
F021 AATGGAACTTGTACAGTAGTAATGAC NA 718 Forward
F022 GTCATTACTACTGTACAAGTTCCATT NA 725 Reverse
F023 TGTGCTCAGGACTTGTYGGAGACACACC NA 970 Forward
F024 GAGTGAAAGGCTGGGCCTTTGATGA NA 1085 Forward
F025 TCATCAAAGGCCCAGCCTTTTACTC NA 1086 Reverse
F026 TAACAACTGGTCTGGTTATTCTGG NA 1200 Forward
F027 CCAGAATAACCAGACCAGTTGTTA NA 1224 Reverse
F028 TCTAAAATTGCGAAAGCTTATATAG NA 1452 Reverse
F029 AAAGAAAGCAGTGTACCATCATTCTGC NA 120 Forward
F030 TGGCTGGAAATGATAAGAGGAA NA 1270 Forward
F031 TTCCTCTTATCATTTCCAGCCA NA 1290 Reverse
F032 TCCTCTCTTCTGGTTTTCCTCTTATCA NA 1300 Reverse
F033 ATGCAAAGTTGAAGGATGGGT NA 240 Forward
F034 ACCCATCCTTCAACCTTGCAT NA 260 Reverse
F035 TGACAATAATAACTGGTCAGG NA 1220 Forward
F036 ATGAAACTCCCGGAGTACCCTGACCA NA 1250 Reverse
F037 TCATCTCCACTCCATTGGGCACTCCACC NA 500 Forward
F038 AGTGCCCAATGGAGTGGAGATGAGACC NA 510 Reverse
F039 AAGTAGATACGTGTGCACTGGAATTCTC NA 960 Forward
F040 TCCAGTGCACACGTATCTACTTGTGTGC NA 980 Reverse
F041 ATAGAACCCTAATGAGCTGTCCTGTTGGT NA 400 Forward
F042 CAACAGGACAGCTCATTAGGGTTCTAT NA 450 Reverse
F043 TATCAAATAGGATACATATGCAG NA 900 Forward
F044 CTGCATATGTATCCTATTTGATA NA 920 Reverse
F045 TGATTTGGGATCCCAATGGGTGGAC NA 1122 Forward
F046 GTCCACCCATTTGGATCCCAAATCA NA 1082 Reverse
F047 ACTCAGCACCGTCTGGCCAAGACCAAC NA 1350 Reverse
F048 AAAGACAACGGAATAAGAATTGG NA 300 Forward
F049 CCAATTCTTATTCCGTTGTCTTTG NA 350 Reverse
F050 GTAGAGACAACTGGACTGGAAC NA 880 Forward
F051 GTTCCAGTCCAGTTGTCTCTAC NA 900 Reverse
F052 GGCAGGGCAATGATGTATGGATGGG NA 1050 Forward
F053 GCTAATGGTCCTRCCCATCCATACATCA NA 1090 Reverse
F054 TCGATGTCAAAAGGAAGAATAGCTCCATC NA 1420 Reverse
F055 ATAAATTCATGGCACATATATGG NA 300 Forward
F056 CCATATATGTGCCATGAATTTAT NA 323 Reverse
F057 GTCAAGTACTAGTTGCCATGATG NA 560 Forward
F058 CATCATGGCAACTAGTACTTGAC NA 580 Reverse
F059 GGATAATTGGCAGGGCTCAAATAG NA 900 Forward
F060 GGTCTATTTGAGCCTTGCCAATTATCC NA 920 Reverse
F061 ACAATAAGCACAGCTTCAAGATC NA 1115 Forward
F062 GATCTTGAAGCTGTGCTTATTGT NA 1137 Reverse
F063 AAGGTGCCAAATGCATTGACC NA 1150 Forward
F064 TCTTAGAGGAAGTACTCTATTTTAGCC NA 1433 Reverse
F065 ATGAATCCAAATCAGAAGATAATATG NA 20 Forward
F066 GCAGAATGTTTGCCCTCAGCCAAGG NA 408 Forward
F067 CCTTGGCTGAGGGCAAACATTCTGC NA 430 Reverse
F068 GTGATGACGGATGGCCCAGC NA 742 Forward
F069 GCTGGGCCATCCGTCATCAC NA 762 Reverse
F070 CCAGATCCTGGCGTAAAAGGATTTGC NA 1056 Forward
F071 GCAAATCCTTTTACGCCAGGATCTGG NA 1082 Reverse
F072 TCATCGATTATTGGGCTGATA NA 1250 Forward
F073 GGCTGAAATCATCTACTTCAAGTA NA 1436 Reverse
F074 CCTTGCTGAATGACAAGCATTC NA 400 Forward
F075 ATTGGAATGTTTGTCATTCAGTAAGG NA 420 Reverse
F076 AGTCCTTACCGTGCATTGATGAGTGT NA 450 Forward
F077 ACACTCATCAATGCACGGTAAGGACT NA 470 Reverse
F078 TGTTATTGGGTAATGACGGATGGTCC NA 700 Forward
F079 GGACCATCCGTCATTACCCAATAACA NA 720 Reverse
F080 TATGTGCTGGAATTCCGACAGACAC NA 950 Forward
F081 GTGTCTGTCGGAATTCCAGCACATA NA 970 Reverse
F082 AAGGATTTGGCTTTAGACAAGG NA 1040 Forward
F083 CCTTGTCTAAAGCCAAATCCTT NA 1060 Reverse
F084 AAGCTACATCTTATCGATGTCA NA 1420 Reverse
F085 AGTAAGGACAACAGCATAAGGATC NA 240 Forward
F086 TAGAACCGATCCTTATGCTGTTGTCC NA 270 Reverse
F087 AGGTTTGAGTCTGTTGCTTGGT NA 420 Forward
F088 ACCAAGCAACAGACTCAAACCT NA 500 Reverse
F089 AGAACTCAAGAGTCTGAATGTG NA 690 Forward
F090 TACACATGCACATTCAGACTCTTG NA 710 Reverse
F091 AGCGGCTTTGAAATGATTTGGGATC NA 1140 Forward
F092 CACCCATTTGGATCCCAAATCAT NA 1120 Reverse
F093 CTACTTGTCAATGGTGAATGGCAA NA 1410 Reverse
F094 CCGCTGTGCCCCTTCAGAGGAT NA 300 Forward
F095 AAAGGGAAGAATCCTCTGAAGG NA 310 Reverse
F096 GTGCGAGAGCAAAGGACCAGCAAT NA 420 Reverse
F097 GACAGACTCCATCAAATCATGGAG NA 640 Forward
F098 CTCCATGATTTGATGGAGTCTGTC NA 660 Reverse
F099 GACAATTGGAAGGGTTCCAAC NA 880 Forward
F100 GTTGGAACCCTTCCAATTGTC NA 900 Reverse
F101 GCTTTGAAATCATCAAAGTTACAG NA 1130 Forward
F102 TTCTGTGACTTTGATGATTTCAAAGC NA 1140 Reverse
F103 CTTGGGCATGAACCCAATGTTGGAACC NA 1410 Reverse
F104 ATCATAACCATCGGCAGTGTTAGTA NA 20 Forward
F105 GTGCAGAACAATTATACCACA NA 200 Forward
F106 TGTGGTATAATTGTTCTGCAC NA 200 Reverse
F107 GAATGTAGGACCTTTTTCTTAAC NA 360 Forward
F108 GTTAAGAAAAAGGTCCTACATTC NA 380 Reverse
F109 AAACACTCAAATGGGACAGTAAAAGACAG NA 400 Forward
F110 ACTGTCCCATTTGAGTGTTTGTCATTA NA 400 Reverse
F111 ATATAATGGTATAATAACAGACAC NA 600 Forward
F112 GTGTCTGTTATTATACCATTATAT NA 620 Reverse
F113 ATGGTAATGGTGTTTGGATAGGGAG NA 1000 Forward
F114 TCCCTATCCAAACACCATTACCATAC NA 1000 Reverse
F115 ATTGGTCTGGTTACAGCGGGAGT NA 1180 Forward
F116 AAACTCCCGCTGTATCCTGACCAAT NA 1200 Reverse
F117 AGAGCGCCATCGGGCCATGACCAACC NA 1400 Reverse
F118 AACAACTACACAAATGTGACC NA 215 Forward
F119 AACACAATGTTGGTCACATTTGTG NA 245 Reverse
F120 ATGGGACTATACATGACAGAAGCCC NA 460 Forward
F121 GGGCTTCTGTCATGTATAGTCCCAT NA 470 Reverse
F122 ATGCATTTGCAGGGACAATTGGAAAGG NA 910 Forward
F123 CCTTTCCAATTGTCCCTGCAAATGCAT NA 900 Reverse
F124 AATGCGGAAACAGACAATCAGTC NA 1160 Forward
F125 GACTGATTGTCTGTTTCCGCATT NA 1180 Reverse
F126 TACTTGAAGTAGATGATTTCAGCC NA 1412 Reverse
F127 AGGGTGATTGAGAATGAATCC NA 20 Forward
F128 ATAAGATTTGGTGAAAGTGAAC NA 350 Forward
F129 TATTATTTGTTCACTTTCACCAAATC NA 360 Reverse
F130 TACATGACAGGACTGCCTTCAGAGG NA 460 Forward
F131 AGTTGATATCAATCCTCTGAAGGC NA 490 Reverse
F132 TTGTGTAGTGGTGATGACTGATGGG NA 720 Forward
F133 CTGACCCATCGGTCATTACTGCTACAC NA 750 Reverse
F134 ACTTGTGTATGCAGGGACAATTGGCA NA 880 Forward
F135 TGCCAATTGTCCCTGCATACACAAGT NA 900 Reverse
F136 ATGTTGAAGGTACCTAATGCTG NA 1150 Forward
F137 CCAGCATTAGGTATCTTCAGCAT NA 1170 Reverse
F138 AAAGTATTGGATTTGTGCCCCATC NA 1420 Reverse
F139 TTCATGAACAATACAGAATCATTG NA 250 Forward
F140 ACCTTGAGTAAGAAAGAACGTCCTGC NA 380 Reverse
F141 TGGCACAGTGAAAGACCGGAGCC NA 410 Forward
F142 GGGCTCCGGTCTTTCACTGTGCCA NA 420 Reverse
F143 AATGGATGACAATTGGAGTAACGG NA 590 Forward
F144 CAGGGCCCGTTACTCCAATTGTCATC NA 600 Reverse
F145 ACCAGCAAACAGACAAGCACAATAC NA 740 Forward
F146 GTATTGTGCTTGTCTGTTTGCTGGT NA 760 Reverse
F147 TATTTCTCCAGATTTGTCTTACAGAGTC NA 910 Forward
F148 AGTATCCGACTCTGTAAGACAAATC NA 930 Reverse
F149 AGGACCATTAGCAGAACATCAAGATC NA 1090 Forward
F150 AAGTTGTGGTTGATAACTTAAATTGGTC NA 1200 Forward
F151 GACCAATTTAAGTTATCAACCACAAC NA 1210 Reverse
F152 AAGTAGAGAATTCAATAACTTGACC NA 250 Forward
F153 GGTCAAGTTATTGAATTCTCTACTT NA 270 Reverse
F154 AAGAGTCTGAATGTGTATGCCACAAC NA 700 Forward
F155 TGTGGCATACACATTCAGACTCTTGTGTCC NA 730 Reverse
F156 CTTATCCGGGAAATAACAACAATGG NA 1040 Forward
F157 CCATTGTTGTTATTTCCTGGGTAAGG NA 1060 Reverse
F158 ACGATAGGTCAAAGCCCACTCAAGG NA 1180 Forward
F159 AGCAAAAGCAGGAGTTTAAAATGAATCC NA 20 Forward
F160 CGATGTCAAAAGGAAGAATAGCTCCATC NA 1420 Reverse
F161 TGCCTGCTAGTGTTACCGGAGCTACAGTTTG NA 218 Reverse
F162 AGGAACGAAGCATAGCAATG NA 428 Reverse
F163 AAGCAGCATTTCCTTTTGTGGAG NA 1340 Forward
F164 GCAGGAGTTTAAAATGAATCC NA 8 Reverse
F165 CAGGAGTTTAAAATGAATCCAAATCAG NA 9 Forward
G001 TATTCGTCTCAGGGAGCAAAAGCAGGTAG M 1 Forward
G002 ATATCGTCTCGTATTAGTAGAAACAAGGTAGTTTTT M 1027 Reverse
G003 GGGAGATAACATTCCATGGG M 339 Forward
G004 TTGAATCGTTGCATCTGTAC M 787 Reverse
G005 CCCATGGAATGTTATCTCCC M 358 Reverse
G006 GTACAGATGCAACGATTCAA M 765 Forward
G007 CCTCGCTCACTGGGCACGGTGAGCGT M 241 Reverse
G008 TGATCTTCTTGAAAATTTGCAGGC M 718 Forward
G009 AGCGAAAGCAGGTAGATGTTGAAAGATG M 30 Forward
G10 CTAATCAGGCATGAGAACAGGATGGT M 530 Forward
G11 CTGTAGTGCTGGCTAAAACCATTCTGT M 580 Reverse
G12 ACAGTCCCCATTCTGTTGTATATAAGGCCCATG M 405 Reverse
G13 ATATCGTCTCGTATTAGTAGAAACAAGGTAG M 1027 Reverse
H001 TATTCGTCTCAGGGAGCAAAAGCAGGGTG NS 1 Forward
H002 ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT NS 890 Reverse
H003 ACTTCAGTGTGATTTTTGACCGG NS 420 Forward
H004 CCGGTCAAAAATCACACTGAA NS 446 Reverse
H005 GAGGATGTCAAAAATGCAGTTG NS 540 Forward
H006 CAATTGCATTTTTGACATCCT NS 560 Reverse
H007 AGCGAAAGCAGGGTGACAAAGACATAATG NS 30 Forward
H08 GGTTCATGCTCATGCCCAAGCAG NS 331 Forward
H09 CTGCTTGGGCATGAGCATGDACC NS 350 Reverse
H10 AACAAGGGTGTTTTTTATCATTAAATAAGCTGAA NS 860 Reverse